Nucleotide and deduced amino acid sequence of the bovine adenovirus type 7 proteinase

 Elektrotechnik

 2 views
of 1
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Description
Nucleotide and deduced amino acid sequence of the bovine adenovirus type 7 proteinase
Share
Tags
Transcript
  5568 Nucleic Acids Research, Vol. 18, No. 18 Nucleotide anddeduced amino acid sequence of the bovineadenovirus type 3 proteinase Faxing Cai*, Martin Bourbonniere, Denis Tang Shiu-Lok Hu1 and Joseph M.Weber Departement de Microbiologie, Faculte de Medecine, Universite de Sherbrooke,Sherbrooke, Quebec JiH 5N4 Canada and 1Oncogen, 3005 First Ave, Seattle WA 98121, USA Submitted July 30, 1990 EMBL accession no. X53990 Adenovirusescode for a novelendoproteinase required for the maturation of infectious virions. The amino acid sequence is highly conserved among the human serotypes but has no homology to known proteinases. The enzyme is inhibited by agentsspecificforserine and for cysteine proteinase  1,2 . To determine theresidues forming the active site we are sequencing the gene indifferent adenoviruses thereby identifying conserved residues as targets for site-specific mutagenesis. BAV 3 viral  N restricted withHindIE[ was cloned into pBR322 and part of the HindI C fragment containing theproteinase was sequenced using primers  based on the hexon sequence published before ,  3 and M13 vectors. 790 nucleotides of the viral 1-strand encoding the 204 residueproteinase is presented. 67 of the residues are identical with those of human adenovirus type 2. ACKNOWLEDGEMENT Supported by grant MT4164 to JMW from the MedicalResearchCouncilof Canada. REFERENCES 1 Houde A.andWeber J.M.  1990 Gene 88, 269 273. 2. Webster,A., Russell,W.C. and Kemp G.D.  1989 J Gen. Virol. 70, 3215 3223. 3. Hu,S.L., Hays W.W. and Potts,D.E. 1984 J Virol. 49, 604 608. ACGTTCTGTTTGAGGTGTTTGACGTGGCCCGCGTTCACCAGCCCCACAGAGGCGTGATCGAAGTGGTGTACTTGAGAACGCCATTCTCAGCCGGCAACGCTACCACATAAGTGCCGGCTTCCCTCTCAGGCCCCGCGATGM GGTTCTCGGGAAGAGGAGCTGAGATTCATCCTTCACGATCTCGGTGTGGGGCCATACTTCCTCGGCACTT G S R E E E L R F I L H D L G V G P Y F L G T TCGATAAACACTTTCCGGGGTTCATCTCCAAAGACCGAATGAGCTGTGCCATAGTCAACACTGCCGGACG FD K H F P G F I S K D RM S C A I V N T A G R CGAAACCGGGGGCGTGCATTGGCTGGCCATGGCTTGGCACCCAGCCTCGCAGACCTTTTACATGTTTGAC ET G G VH W L A M AW H P A S Q TF YM F D CCTTTCGGTTTCTCGGATCAAAAGCTAAAGCAAATTTACAACTTTGAGTATCAGGGCCTCCTAAAGCGCA P F G F S D Q K LK Q I Y NF E Y Q G L L KR GCGCCCTGACTTCCACTGCTGACCGCTGCCTGACCCTTATTCAAAGCACTCAATCTGTCCAGGGACCCAA S AL T S T A D R C L T L I Q S T Q S V Q G P N CAGCGCCGCCTGCGGTCTGTTCTGCTGCATGTTCCTCCACGCCTTTGTCCGCTGGCCGCTTAGGGCCATG S A   C G L F CC M F LH A F V R W P L R AM GACAACAATCCCACCATGAACCTCATCCACGGAGTTCCCAACAACATGTTGGAGAGCCCCAGCTCCCAAA DNN P T M NL I H G V P NN M L E S P S S Q ATGTGTTTTTGAGAAACCAGCAAAATCTGTACCGTTTCCTAAGACGCCACTCCCCCCATTTTGTTAAGCA N V F LRN Q QN L Y R F LRR H S P H F VK H TGCGGCTCAAATTGAGGCTGACACCGCCTTTGATAAAATGTTAACAAATTAGACCGTGAGCCATGATTGCAA Q I E A DT A F D K M L T N AGAAGCATGTCATTTTTTTT   To whom correspondence should be addressed 70 140210 280 350 420 490 560630 700 770790 Q D 1990 Oxford University Press
Related Search
Similar documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks